SEA-PHAGES | All posts created by cdshaffer

← previous
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
next →

Link to this post \| posted 08 May, 2017 19:13
cdshaffer	Sorry this took so long. I was so buried with grading final reports I did not have time to check the forums until today. Here is your DismalFund starterator report It is in the standard format, there is also a new experimental output (See this discussion for example). If you would like the report in that forma let me know, it is trivial easy to rerun.

Posted in: Starterator → phage that crash starterator

Link to this post \| posted 27 Apr, 2017 21:46
cdshaffer	Two questions: simple one first: What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes? Now with complications: We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type. Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan): `ca c g t-a g-c t-a c-g a-t c-g a-t tg t cactc a aa a !!!!! a t ttcg gtgag c g !!!! t tt g aagc a gca a g g-c t-a c-g t-a a-t a a g c gc tRNA-?(Ala\|Gly)(gc) 73 bases, %GC = 46.6 Sequence [97925,97997] Primary sequence for tRNA-?(Ala\|Gly)(gc) 1 . 10 . 20 . 30 . 40 . 50 tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag ttcaagtctcactgtgacagcca` What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Link to this post | posted 27 Apr, 2017 21:46

cdshaffer

Two questions: simple one first:

What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes?

Now with complications:

We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type.

Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan):


                 ca
                c
               g
             t-a
             g-c
             t-a
             c-g
             a-t
             c-g
             a-t     tg
            t   cactc  a
     aa    a    !!!!!  a
    t  ttcg     gtgag  c
   g   !!!!     t    tt
   g   aagc    a
    gca    a   g
            g-c
            t-a
            c-g
            t-a
            a-t
           a   a
           g  c
            gc
    tRNA-?(Ala|Gly)(gc)
    73 bases, %GC = 46.6
    Sequence [97925,97997]
Primary sequence for tRNA-?(Ala|Gly)(gc)
1   .   10    .   20    .   30    .   40    .   50
tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag
ttcaagtctcactgtgacagcca

What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Posted in: tRNAs → undetermined tRNA's

Link to this post \| posted 27 Apr, 2017 16:14
cdshaffer	As much as I love the command line (and I do really), if you want to use the finder to delete everything: 1. select the finder 2. Hold down the Option Key while you select the GO menu 3. Select Library to open a finder window of your Library folder 4. Double click to open "Application Support" folder 5. Drag the Wine and edu.baylor… folders to the trash 6. Proceed with re-installation Also, I just tried a BLAST search with a fresh wine bottle install (and update of DNA Master) and I too got the OLE error. Tried on my windows virtualbox and BLAST worked just fine.

Link to this post | posted 27 Apr, 2017 16:14

cdshaffer

As much as I love the command line (and I do really), if you want to use the finder to delete everything:

1. select the finder
2. Hold down the Option Key while you select the GO menu
3. Select Library to open a finder window of your Library folder
4. Double click to open "Application Support" folder
5. Drag the Wine and edu.baylor… folders to the trash
6. Proceed with re-installation

Also, I just tried a BLAST search with a fresh wine bottle install (and update of DNA Master) and I too got the OLE error. Tried on my windows virtualbox and BLAST worked just fine.

Posted in: DNA Master → Running DNA Master on a Mac using Wine

Link to this post \| posted 22 Apr, 2017 21:18
cdshaffer	Here is a possible version of the report that changes the "Summary by start number" section. http://phages.wustl.edu/Pham6711Report.pdf I have tried to incorporate the above discussion by including info on how often a given start is found in the pham as well as how often it is called as the start of the protein. You can compare it to the current version here: http://phages.wustl.edu/103/Pham6711Report.pdf Feedback would be appreciated

Link to this post | posted 22 Apr, 2017 21:18

cdshaffer

Here is a possible version of the report that changes the "Summary by start number" section.

http://phages.wustl.edu/Pham6711Report.pdf

I have tried to incorporate the above discussion by including info on how often a given start is found in the pham as well as how often it is called as the start of the protein. You can compare it to the current version here:

http://phages.wustl.edu/103/Pham6711Report.pdf

Feedback would be appreciated

Posted in: Starterator → Suggestions for Starterator Report Upgrades

Link to this post \| posted 13 Apr, 2017 21:15
cdshaffer	Marsha, Happy to help. It's too bad all the updates I wrote last fall were too late for inclusion in the SEA VM for 2017. The good news is that its fairly easy for me to set up a run on a whole phage, the computer does all the hard work anyway. You can get the full report from this link. The output is different that what is produced with the older version. The report now focus on the human annotated genes more and the auto-annotations less. I hope you find it useful.

Link to this post | posted 13 Apr, 2017 21:15

cdshaffer

Marsha,
Happy to help. It's too bad all the updates I wrote last fall were too late for inclusion in the SEA VM for 2017. The good news is that its fairly easy for me to set up a run on a whole phage, the computer does all the hard work anyway. You can get the full report from this link. The output is different that what is produced with the older version. The report now focus on the human annotated genes more and the auto-annotations less. I hope you find it useful.

Posted in: Starterator → phage that crash starterator

Link to this post \| posted 12 Apr, 2017 18:16
cdshaffer	OK, It looks like your VM may be stuck on an old version of the database as I can see purgamenstris in my local phamerator database and I can see it on the phamerator.org website listed with the other cluster N phages. It may be that your VM cannot get to the internet or some other issue with the auto-update function of phamerator. You can test the VM's access to the internet if you open either chrome or firefox (both should be in the left hand icon bar) and make sure you can open a web page. If its the auto-update system you could try to force an update to the database. In phamerator select edit => preferences and click the "force database update" button. Then be patient as it can take a while before anything visible happens, (depends on your exact VM/host computer setup; takes about 3 minutes with a really fast hard drive, up to 10+ minutes on the sloweest systems). At some point you should get a button to "restart now", click that, then wait a while longer. Eventually phamerator will become available again and you will see a "database is already the newest version" message at the bottom of the window. If the internet is working for the VM and the force update does not fix then post again.

Link to this post | posted 12 Apr, 2017 18:16

cdshaffer

OK,
It looks like your VM may be stuck on an old version of the database as I can see purgamenstris in my local phamerator database and I can see it on the phamerator.org website listed with the other cluster N phages.

It may be that your VM cannot get to the internet or some other issue with the auto-update function of phamerator.

You can test the VM's access to the internet if you open either chrome or firefox (both should be in the left hand icon bar) and make sure you can open a web page.

If its the auto-update system you could try to force an update to the database. In phamerator select edit => preferences and click the "force database update" button. Then be patient as it can take a while before anything visible happens, (depends on your exact VM/host computer setup; takes about 3 minutes with a really fast hard drive, up to 10+ minutes on the sloweest systems). At some point you should get a button to "restart now", click that, then wait a while longer. Eventually phamerator will become available again and you will see a "database is already the newest version" message at the bottom of the window.

If the internet is working for the VM and the force update does not fix then post again.

Posted in: Phamerator → Missing phage in Phamerator database

Link to this post \| posted 10 Apr, 2017 23:53
cdshaffer	Purgamenstris is now an N cluster phage see: http://phagesdb.org/phages/Purgamenstris/

Posted in: Phamerator → Missing phage in Phamerator database

Link to this post \| posted 29 Mar, 2017 17:18
cdshaffer	OK i have updated this issue for Starterator on the issue tracker. You can see the issue posted here. There are still some unresolved bugs/crashes as well as some ideas for other changes on the issue tracker as well. Not sure how easy difficult this change will be to implement, so not sure if/when it will be added. It should be fairly easy in theory but some of the data constructs are a little tricky to work with, especially the ones in the section of the code that generates the PDF, so it will take some time to dig into the code and see what can be done.

Link to this post | posted 29 Mar, 2017 17:18

cdshaffer

OK i have updated this issue for Starterator on the issue tracker. You can see the issue posted here. There are still some unresolved bugs/crashes as well as some ideas for other changes on the issue tracker as well.

Not sure how easy difficult this change will be to implement, so not sure if/when it will be added. It should be fairly easy in theory but some of the data constructs are a little tricky to work with, especially the ones in the section of the code that generates the PDF, so it will take some time to dig into the code and see what can be done.

Posted in: Starterator → Suggestions for Starterator Report Upgrades

Link to this post \| posted 29 Mar, 2017 01:59
cdshaffer	name: root password: phage

Posted in: Phamerator → Force A Database Update? How?

Link to this post \| posted 29 Mar, 2017 01:58
cdshaffer	Having dealt with these new reports in class I agree that the current set of calculated numbers are not the best with higher variance phams. In our discussions last fall we wanted to get away from the "Suggested Start" because it was counting both human and computational annotations equally and thus putting too much emphasis on glimmer/genemark. I wonder if a good number to report is the fraction of times a start is annotated as the start of the gene but only consider the manually annotated genes that actually have that start present. I can see two places to put that kind of info that might help, in the "Summary by start number" section and/or in the "Gene information" section. Here are examples, the details of which can easily be changed but it gives you the idea and something to comment on: `Summary by start number • Start number 18 is called in: Spectropatronm_Draft_2, Rima_2, Namo_2, Percent of genes with start 18 present: 37.5% ( 3 of 8 ) Start 18 was manually annotated as the start 100% (2 of 2) of the time when present. • Start number 19 is called in: Scap1_2, Percent of genes with start 19 present: 25.0% ( 2 of 8 ) Start 19 is called as the start 50% of the time when present (1 of 2).` So in the above example I image there are 8 members of the pham, start 18 is present in 3 of the 8 members so starterator reports "present in 37.5%". Of those three members that have start 18, two have been manually annotated (Rima and Namo) and in both cases start 18 was the annotated start of the gene. Thus starterator reports 2 out of 2 or 100%. For start 19, it is present in 2 phage (Scap1, and one other), both are manually annotated but in only one of them was 19 the annotated start so starterator reports 50%. Thus we have a % presence with examines all genes and gives a sense of overall levels of conservation, and a % manually annotated which gives the fraction of the time it is picked when present. A different way to encode the same would be to put those in the Gene info like this: `Gene information •Gene: Spectropatronm_Draft_2 Start: 485, Stop: 892 Candidate Starts for Spectropatronm_Draft_2: [(5, 395, 0%), (18, 485, 100%), (19, 563, 50%)]` I guess a third option is to do both. I am a little reticent to put lots of details into the Gene information since that section gets quite long already for phams with lots of members and long genes. It would be great to hear feedback on any of the above. I agree that more would be needed, I am just not sure if there is something better. Are there tweeks to the above that make better sense to you? Are there other numbers that could be calculated and reported that would be more informative? Thoughtful feedback is much appreciated.

Link to this post | posted 29 Mar, 2017 01:58

cdshaffer

Having dealt with these new reports in class I agree that the current set of calculated numbers are not the best with higher variance phams. In our discussions last fall we wanted to get away from the "Suggested Start" because it was counting both human and computational annotations equally and thus putting too much emphasis on glimmer/genemark.

I wonder if a good number to report is the fraction of times a start is annotated as the start of the gene but only consider the manually annotated genes that actually have that start present.

I can see two places to put that kind of info that might help, in the "Summary by start number" section and/or in the "Gene information" section. Here are examples, the details of which can easily be changed but it gives you the idea and something to comment on:

Summary by start number
• Start number 18 is called in: Spectropatronm_Draft_2, Rima_2, Namo_2,
Percent of genes with start 18 present: 37.5% ( 3 of 8 )
Start 18 was manually annotated as the start 100% (2 of 2) of the time when present.

• Start number 19 is called in: Scap1_2,
Percent of genes with start 19 present: 25.0% ( 2 of 8 )
Start 19 is called as the start 50% of the time when present (1 of 2).

So in the above example I image there are 8 members of the pham, start 18 is present in 3 of the 8 members so starterator reports "present in 37.5%". Of those three members that have start 18, two have been manually annotated (Rima and Namo) and in both cases start 18 was the annotated start of the gene. Thus starterator reports 2 out of 2 or 100%. For start 19, it is present in 2 phage (Scap1, and one other), both are manually annotated but in only one of them was 19 the annotated start so starterator reports 50%. Thus we have a % presence with examines all genes and gives a sense of overall levels of conservation, and a % manually annotated which gives the fraction of the time it is picked when present.

A different way to encode the same would be to put those in the Gene info like this:

Gene information
•Gene: Spectropatronm_Draft_2 Start: 485, Stop: 892
Candidate Starts for Spectropatronm_Draft_2:
[(5, 395, 0%), (18, 485, 100%), (19, 563, 50%)]

I guess a third option is to do both.

I am a little reticent to put lots of details into the Gene information since that section gets quite long already for phams with lots of members and long genes.

It would be great to hear feedback on any of the above. I agree that more would be needed, I am just not sure if there is something better. Are there tweeks to the above that make better sense to you? Are there other numbers that could be calculated and reported that would be more informative? Thoughtful feedback is much appreciated.

Posted in: Starterator → Suggestions for Starterator Report Upgrades

← previous
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
next →

Recent Activity

All posts created by cdshaffer