SEA-PHAGES | All posts created by cdshaffer

← previous
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
next →

Link to this post \| posted 17 Aug, 2017 16:00
cdshaffer	I just tried to run the update on my Windows 7 machine and it worked fine, so yes the ftp server appears to be up so that is not the issue. Sorry but not a Win 10 expert but I think you are right is is some kind of setting on the pro version, likely for heightened security

Posted in: DNA Master → FTP Error on Windows 10 Pro

Link to this post \| posted 14 Aug, 2017 17:47
cdshaffer	Likely a database update issue since I was not able to login and update the database for about a week. I just posted the most recent version of the database to the starterator website. Check now and post again if still missing.

Posted in: Starterator → Updates to Starterator output

Link to this post \| posted 19 Jul, 2017 17:12
cdshaffer	It is not you or your system. I am getting the same result. It looks like NCBI is no longer serving glimmer and genemark analysis as a web page (which is what DNA Master used) and is now forwarding all web requests for those pages to the download pages of the software. This totally breaks DNA Master auto-annotation as you have discovered. A long term solution is going to require updates to DNA Master. In the short term, it is probably easiest to use PECAAN. You can start here: https://seaphages.org/forums/topic/224/ Which explains how to get an account and a link to the user guide. PECAAN is under very active development so the user guide will help get you started but expect the actual web pages to be different. Pecaan is nice in that it will do a lot of the drudgery of entering notes in a proper format if you use it to do all your annotations. So you may want to consider switching over to using it for a lot of the annotation work. If you are in a huge hurry (like you need the DNA Master file ASAP for a class) just post the name of the phage I can use pecaan to generate the auto-annotation file for you very easily. If you want to try to use pecaan to do most of your annotation, feel free to post any follow=up questions to the PECAAN section of the forum.

Link to this post | posted 19 Jul, 2017 17:12

cdshaffer

It is not you or your system. I am getting the same result. It looks like NCBI is no longer serving glimmer and genemark analysis as a web page (which is what DNA Master used) and is now forwarding all web requests for those pages to the download pages of the software.
This totally breaks DNA Master auto-annotation as you have discovered. A long term solution is going to require updates to DNA Master.

In the short term, it is probably easiest to use PECAAN. You can start here:

https://seaphages.org/forums/topic/224/

Which explains how to get an account and a link to the user guide. PECAAN is under very active development so the user guide will help get you started but expect the actual web pages to be different. Pecaan is nice in that it will do a lot of the drudgery of entering notes in a proper format if you use it to do all your annotations. So you may want to consider switching over to using it for a lot of the annotation work.

If you are in a huge hurry (like you need the DNA Master file ASAP for a class) just post the name of the phage I can use pecaan to generate the auto-annotation file for you very easily.

If you want to try to use pecaan to do most of your annotation, feel free to post any follow=up questions to the PECAAN section of the forum.

Posted in: DNA Master → Glimmer Failure on Auto Annotation

Link to this post \| posted 03 Jul, 2017 16:55
cdshaffer	I would go with the sequence as is then (i.e. 6 G's). The sequencing error hypothesis was always a bit of a long shot since the consensus was too long and as I mentioned 454 typically makes consensus errors by making mononucleotide runs too short. As for annotation, that is up to Veronique & Welkin.

Posted in: Gene or not a Gene → Gene split in 2

Link to this post \| posted 16 Jun, 2017 19:28
cdshaffer	This looks very suspicious to me. According to the phage page it was sequenced in 2014 using 454 technology. I would not be surprised if you have a sequencing error here. The 1 indel you are finding is right at a mono-nucleotide run of 6 G: `Query: 28901 aggcgaactcttatggccccacgttcccgtacacggcgtcggcggggggcggacgtgttc 28960 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\| Sbjct: 28916 aggcgaactcttatggccccacgttcccgtacacggcgtcggcagggg-cggacgtgttc 28974` (Smairt is query, GageAP is Sbjct; but this same exact alignment is seen 10 different phage) 454 technology is notorious for mono-nucleotide run errors (although it usually gets them too short not too long). You should ask Dan to review the assembly in consed (if he has the assembly). I would bet good money the 454 data for that region has some reads with 5 G's and some reads with 6 G's. It is also possible that Consed made an assembly error giving too much validity to low quality reads and mis-aligning all the high quality data, I have seen that happen a few times. I would not be doing any more annotation work on this one until the validity of the sequence in this region is confirmed. Edited 16 Jun, 2017 19:33

Link to this post | posted 16 Jun, 2017 19:28

cdshaffer

This looks very suspicious to me. According to the phage page it was sequenced in 2014 using 454 technology. I would not be surprised if you have a sequencing error here. The 1 indel you are finding is right at a mono-nucleotide run of 6 G:


Query: 28901 aggcgaactcttatggccccacgttcccgtacacggcgtcggcggggggcggacgtgttc 28960
             ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 28916 aggcgaactcttatggccccacgttcccgtacacggcgtcggcagggg-cggacgtgttc 28974

(Smairt is query, GageAP is Sbjct; but this same exact alignment is seen 10 different phage)

454 technology is notorious for mono-nucleotide run errors (although it usually gets them too short not too long). You should ask Dan to review the assembly in consed (if he has the assembly). I would bet good money the 454 data for that region has some reads with 5 G's and some reads with 6 G's. It is also possible that Consed made an assembly error giving too much validity to low quality reads and mis-aligning all the high quality data, I have seen that happen a few times.

I would not be doing any more annotation work on this one until the validity of the sequence in this region is confirmed.

Edited 16 Jun, 2017 19:33

Posted in: Gene or not a Gene → Gene split in 2

Link to this post \| posted 05 Jun, 2017 19:27
cdshaffer	Based on feedback and suggestions from users over the spring I have updated the starterator output for the current pham reports that are posted to the http://phages.wustl.edu/starterator/ web site. You can compare the old version with the new version This new format will be used from version 119 (the version posted today) of the database and beyond. Please feel free to post any feedback (good or bad) on this new format. Edited 05 Jun, 2017 19:29

Link to this post | posted 05 Jun, 2017 19:27

cdshaffer

Based on feedback and suggestions from users over the spring I have updated the starterator output for the current pham reports that are posted to the http://phages.wustl.edu/starterator/ web site.

You can compare the old version with the new version

This new format will be used from version 119 (the version posted today) of the database and beyond. Please feel free to post any feedback (good or bad) on this new format.

Edited 05 Jun, 2017 19:29

Posted in: Starterator → Updates to Starterator output

Link to this post \| posted 30 May, 2017 21:42
cdshaffer	When I am doing de novo annotation and I like to maximize sensitivity and on the old system that meant I would pick most of the databases. With the new site I am only getting 4 listed. I have been going with the default PDB because I was just double checking. I would probably add the Scope95 and the Pfam when I want a broad search with maximum sensitivity.

Posted in: Annotation → New HHPred web site

Link to this post \| posted 30 May, 2017 15:14
cdshaffer	The new site is working for me. Just in case it is a browser issue: I used the chrome browser on a mac in the past and I just tried chrome on my windows 7 virtual machine worked ok there as well.

Posted in: Annotation → New HHPred web site

Link to this post \| posted 08 May, 2017 19:13
cdshaffer	Sorry this took so long. I was so buried with grading final reports I did not have time to check the forums until today. Here is your DismalFund starterator report It is in the standard format, there is also a new experimental output (See this discussion for example). If you would like the report in that forma let me know, it is trivial easy to rerun.

Posted in: Starterator → phage that crash starterator

Link to this post \| posted 27 Apr, 2017 21:46
cdshaffer	Two questions: simple one first: What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes? Now with complications: We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type. Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan): `ca c g t-a g-c t-a c-g a-t c-g a-t tg t cactc a aa a !!!!! a t ttcg gtgag c g !!!! t tt g aagc a gca a g g-c t-a c-g t-a a-t a a g c gc tRNA-?(Ala\|Gly)(gc) 73 bases, %GC = 46.6 Sequence [97925,97997] Primary sequence for tRNA-?(Ala\|Gly)(gc) 1 . 10 . 20 . 30 . 40 . 50 tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag ttcaagtctcactgtgacagcca` What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Link to this post | posted 27 Apr, 2017 21:46

cdshaffer

Two questions: simple one first:

What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes?

Now with complications:

We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type.

Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan):


                 ca
                c
               g
             t-a
             g-c
             t-a
             c-g
             a-t
             c-g
             a-t     tg
            t   cactc  a
     aa    a    !!!!!  a
    t  ttcg     gtgag  c
   g   !!!!     t    tt
   g   aagc    a
    gca    a   g
            g-c
            t-a
            c-g
            t-a
            a-t
           a   a
           g  c
            gc
    tRNA-?(Ala|Gly)(gc)
    73 bases, %GC = 46.6
    Sequence [97925,97997]
Primary sequence for tRNA-?(Ala|Gly)(gc)
1   .   10    .   20    .   30    .   40    .   50
tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag
ttcaagtctcactgtgacagcca

What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Posted in: tRNAs → undetermined tRNA's

← previous
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
next →

Recent Activity

All posts created by cdshaffer