Link to this post | posted 22 Aug, 2017 16:29

cdshaffer

Sorry about that, we are having network upgrades here that have made it difficult to run the starterator updates. Until these are fixed starterator may lag a bit more than usual on when updates get posted. There was also a rollback of the phamerator database from version 141 back to version 140. I just rolled the starterator reports back so all the reports at phages.wustl.edu should now be in sync with version 140 which was run on 8/14/17 and should match phagesdb and phamerator.org.

Link to this post | posted 18 Aug, 2017 22:14

cdshaffer

just to document for anyone what wants to create an auto-annotation here is what I did: 1. open DNA Master and do the standard File -> Open Fasta and import the sequence 2. Go go https://discover.kbrinsgd.org/autoannotate/ and enter phage name and upload the same sequence file you used in step 1 3. Click "Process" 4. In the text box below the process button you will get the auto-annotation as "Documentation"; it will have a bunch of entries that look something like this: CDS 15 - 272 /gene="1" /product="gp1" /locus tag="Roots515_1" 5. Select and Copy the entire contents of that text box 6. Go back to DNA master, on the phage window click the "Documentation" tab at the top right 7. Delete any text in the large text box and paste in from the results from the PECAAN auto-annotation. (When I did this this step I got about 100 question marks at the end which I deleted so the last entry ended like this: CDS join(155929. .156288;1. .1 /gene="232" /product="gp232" /locus tag="Roots515_232" /note=Original Glimmer call @bp 155929 has strength 11.01 ** not called by GeneMark 8. click the parse button, then in the window that opens accept the defaults and click the new parse button. This will convert the "documentation" into DNA Master gene entries 9. Save the DNA Master file as usual Edited 18 Aug, 2017 22:22

Link to this post | posted 17 Aug, 2017 16:00
cdshaffer	I just tried to run the update on my Windows 7 machine and it worked fine, so yes the ftp server appears to be up so that is not the issue. Sorry but not a Win 10 expert but I think you are right is is some kind of setting on the pro version, likely for heightened security

Link to this post | posted 14 Aug, 2017 17:47
cdshaffer	Likely a database update issue since I was not able to login and update the database for about a week. I just posted the most recent version of the database to the starterator website. Check now and post again if still missing.

Link to this post | posted 19 Jul, 2017 17:12

cdshaffer

It is not you or your system. I am getting the same result. It looks like NCBI is no longer serving glimmer and genemark analysis as a web page (which is what DNA Master used) and is now forwarding all web requests for those pages to the download pages of the software. This totally breaks DNA Master auto-annotation as you have discovered. A long term solution is going to require updates to DNA Master. In the short term, it is probably easiest to use PECAAN. You can start here: https://seaphages.org/forums/topic/224/ Which explains how to get an account and a link to the user guide. PECAAN is under very active development so the user guide will help get you started but expect the actual web pages to be different. Pecaan is nice in that it will do a lot of the drudgery of entering notes in a proper format if you use it to do all your annotations. So you may want to consider switching over to using it for a lot of the annotation work. If you are in a huge hurry (like you need the DNA Master file ASAP for a class) just post the name of the phage I can use pecaan to generate the auto-annotation file for you very easily. If you want to try to use pecaan to do most of your annotation, feel free to post any follow=up questions to the PECAAN section of the forum.

Link to this post | posted 03 Jul, 2017 16:55
cdshaffer	I would go with the sequence as is then (i.e. 6 G's). The sequencing error hypothesis was always a bit of a long shot since the consensus was too long and as I mentioned 454 typically makes consensus errors by making mononucleotide runs too short. As for annotation, that is up to Veronique & Welkin.

Link to this post | posted 16 Jun, 2017 19:28

cdshaffer

This looks very suspicious to me. According to the phage page it was sequenced in 2014 using 454 technology. I would not be surprised if you have a sequencing error here. The 1 indel you are finding is right at a mono-nucleotide run of 6 G: Query: 28901 aggcgaactcttatggccccacgttcccgtacacggcgtcggcggggggcggacgtgttc 28960 ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 28916 aggcgaactcttatggccccacgttcccgtacacggcgtcggcagggg-cggacgtgttc 28974 (Smairt is query, GageAP is Sbjct; but this same exact alignment is seen 10 different phage) 454 technology is notorious for mono-nucleotide run errors (although it usually gets them too short not too long). You should ask Dan to review the assembly in consed (if he has the assembly). I would bet good money the 454 data for that region has some reads with 5 G's and some reads with 6 G's. It is also possible that Consed made an assembly error giving too much validity to low quality reads and mis-aligning all the high quality data, I have seen that happen a few times. I would not be doing any more annotation work on this one until the validity of the sequence in this region is confirmed. Edited 16 Jun, 2017 19:33

Link to this post | posted 05 Jun, 2017 19:27

cdshaffer

Based on feedback and suggestions from users over the spring I have updated the starterator output for the current pham reports that are posted to the http://phages.wustl.edu/starterator/ web site. You can compare the old version with the new version This new format will be used from version 119 (the version posted today) of the database and beyond. Please feel free to post any feedback (good or bad) on this new format. Edited 05 Jun, 2017 19:29

Link to this post | posted 30 May, 2017 21:42
cdshaffer	When I am doing de novo annotation and I like to maximize sensitivity and on the old system that meant I would pick most of the databases. With the new site I am only getting 4 listed. I have been going with the default PDB because I was just double checking. I would probably add the Scope95 and the Pfam when I want a broad search with maximum sensitivity.

Link to this post | posted 30 May, 2017 15:14
cdshaffer	The new site is working for me. Just in case it is a browser issue: I used the chrome browser on a mac in the past and I just tried chrome on my windows 7 virtual machine worked ok there as well.