SEA-PHAGES | All posts created by cdshaffer

← previous
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
next →

Link to this post \| posted 16 Jun, 2017 19:28
cdshaffer	This looks very suspicious to me. According to the phage page it was sequenced in 2014 using 454 technology. I would not be surprised if you have a sequencing error here. The 1 indel you are finding is right at a mono-nucleotide run of 6 G: `Query: 28901 aggcgaactcttatggccccacgttcccgtacacggcgtcggcggggggcggacgtgttc 28960 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\| Sbjct: 28916 aggcgaactcttatggccccacgttcccgtacacggcgtcggcagggg-cggacgtgttc 28974` (Smairt is query, GageAP is Sbjct; but this same exact alignment is seen 10 different phage) 454 technology is notorious for mono-nucleotide run errors (although it usually gets them too short not too long). You should ask Dan to review the assembly in consed (if he has the assembly). I would bet good money the 454 data for that region has some reads with 5 G's and some reads with 6 G's. It is also possible that Consed made an assembly error giving too much validity to low quality reads and mis-aligning all the high quality data, I have seen that happen a few times. I would not be doing any more annotation work on this one until the validity of the sequence in this region is confirmed. Edited 16 Jun, 2017 19:33

Link to this post | posted 16 Jun, 2017 19:28

This looks very suspicious to me. According to the phage page it was sequenced in 2014 using 454 technology. I would not be surprised if you have a sequencing error here. The 1 indel you are finding is right at a mono-nucleotide run of 6 G:


Query: 28901 aggcgaactcttatggccccacgttcccgtacacggcgtcggcggggggcggacgtgttc 28960
             ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 28916 aggcgaactcttatggccccacgttcccgtacacggcgtcggcagggg-cggacgtgttc 28974

(Smairt is query, GageAP is Sbjct; but this same exact alignment is seen 10 different phage)

454 technology is notorious for mono-nucleotide run errors (although it usually gets them too short not too long). You should ask Dan to review the assembly in consed (if he has the assembly). I would bet good money the 454 data for that region has some reads with 5 G's and some reads with 6 G's. It is also possible that Consed made an assembly error giving too much validity to low quality reads and mis-aligning all the high quality data, I have seen that happen a few times.

I would not be doing any more annotation work on this one until the validity of the sequence in this region is confirmed.

Edited 16 Jun, 2017 19:33

Posted in: Gene or not a Gene → Gene split in 2

Link to this post \| posted 05 Jun, 2017 19:27
cdshaffer	Based on feedback and suggestions from users over the spring I have updated the starterator output for the current pham reports that are posted to the http://phages.wustl.edu/starterator/ web site. You can compare the old version with the new version This new format will be used from version 119 (the version posted today) of the database and beyond. Please feel free to post any feedback (good or bad) on this new format. Edited 05 Jun, 2017 19:29

Link to this post | posted 05 Jun, 2017 19:27

cdshaffer

Based on feedback and suggestions from users over the spring I have updated the starterator output for the current pham reports that are posted to the http://phages.wustl.edu/starterator/ web site.

You can compare the old version with the new version

This new format will be used from version 119 (the version posted today) of the database and beyond. Please feel free to post any feedback (good or bad) on this new format.

Edited 05 Jun, 2017 19:29

Posted in: Starterator → Updates to Starterator output

Link to this post \| posted 30 May, 2017 21:42
cdshaffer	When I am doing de novo annotation and I like to maximize sensitivity and on the old system that meant I would pick most of the databases. With the new site I am only getting 4 listed. I have been going with the default PDB because I was just double checking. I would probably add the Scope95 and the Pfam when I want a broad search with maximum sensitivity.

Posted in: Annotation → New HHPred web site

Link to this post \| posted 30 May, 2017 15:14
cdshaffer	The new site is working for me. Just in case it is a browser issue: I used the chrome browser on a mac in the past and I just tried chrome on my windows 7 virtual machine worked ok there as well.

Posted in: Annotation → New HHPred web site

Link to this post \| posted 08 May, 2017 19:13
cdshaffer	Sorry this took so long. I was so buried with grading final reports I did not have time to check the forums until today. Here is your DismalFund starterator report It is in the standard format, there is also a new experimental output (See this discussion for example). If you would like the report in that forma let me know, it is trivial easy to rerun.

Posted in: Starterator → phage that crash starterator

Link to this post \| posted 27 Apr, 2017 21:46
cdshaffer	Two questions: simple one first: What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes? Now with complications: We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type. Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan): `ca c g t-a g-c t-a c-g a-t c-g a-t tg t cactc a aa a !!!!! a t ttcg gtgag c g !!!! t tt g aagc a gca a g g-c t-a c-g t-a a-t a a g c gc tRNA-?(Ala\|Gly)(gc) 73 bases, %GC = 46.6 Sequence [97925,97997] Primary sequence for tRNA-?(Ala\|Gly)(gc) 1 . 10 . 20 . 30 . 40 . 50 tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag ttcaagtctcactgtgacagcca` What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Link to this post | posted 27 Apr, 2017 21:46

cdshaffer

Two questions: simple one first:

What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes?

Now with complications:

We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type.

Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan):


                 ca
                c
               g
             t-a
             g-c
             t-a
             c-g
             a-t
             c-g
             a-t     tg
            t   cactc  a
     aa    a    !!!!!  a
    t  ttcg     gtgag  c
   g   !!!!     t    tt
   g   aagc    a
    gca    a   g
            g-c
            t-a
            c-g
            t-a
            a-t
           a   a
           g  c
            gc
    tRNA-?(Ala|Gly)(gc)
    73 bases, %GC = 46.6
    Sequence [97925,97997]
Primary sequence for tRNA-?(Ala|Gly)(gc)
1   .   10    .   20    .   30    .   40    .   50
tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag
ttcaagtctcactgtgacagcca

What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Posted in: tRNAs → undetermined tRNA's

Link to this post \| posted 27 Apr, 2017 16:14
cdshaffer	As much as I love the command line (and I do really), if you want to use the finder to delete everything: 1. select the finder 2. Hold down the Option Key while you select the GO menu 3. Select Library to open a finder window of your Library folder 4. Double click to open "Application Support" folder 5. Drag the Wine and edu.baylor… folders to the trash 6. Proceed with re-installation Also, I just tried a BLAST search with a fresh wine bottle install (and update of DNA Master) and I too got the OLE error. Tried on my windows virtualbox and BLAST worked just fine.

Link to this post | posted 27 Apr, 2017 16:14

cdshaffer

As much as I love the command line (and I do really), if you want to use the finder to delete everything:

1. select the finder
2. Hold down the Option Key while you select the GO menu
3. Select Library to open a finder window of your Library folder
4. Double click to open "Application Support" folder
5. Drag the Wine and edu.baylor… folders to the trash
6. Proceed with re-installation

Also, I just tried a BLAST search with a fresh wine bottle install (and update of DNA Master) and I too got the OLE error. Tried on my windows virtualbox and BLAST worked just fine.

Posted in: DNA Master → Running DNA Master on a Mac using Wine

Link to this post \| posted 22 Apr, 2017 21:18
cdshaffer	Here is a possible version of the report that changes the "Summary by start number" section. http://phages.wustl.edu/Pham6711Report.pdf I have tried to incorporate the above discussion by including info on how often a given start is found in the pham as well as how often it is called as the start of the protein. You can compare it to the current version here: http://phages.wustl.edu/103/Pham6711Report.pdf Feedback would be appreciated

Link to this post | posted 22 Apr, 2017 21:18

cdshaffer

Here is a possible version of the report that changes the "Summary by start number" section.

http://phages.wustl.edu/Pham6711Report.pdf

I have tried to incorporate the above discussion by including info on how often a given start is found in the pham as well as how often it is called as the start of the protein. You can compare it to the current version here:

http://phages.wustl.edu/103/Pham6711Report.pdf

Feedback would be appreciated

Posted in: Starterator → Suggestions for Starterator Report Upgrades

Link to this post \| posted 13 Apr, 2017 21:15
cdshaffer	Marsha, Happy to help. It's too bad all the updates I wrote last fall were too late for inclusion in the SEA VM for 2017. The good news is that its fairly easy for me to set up a run on a whole phage, the computer does all the hard work anyway. You can get the full report from this link. The output is different that what is produced with the older version. The report now focus on the human annotated genes more and the auto-annotations less. I hope you find it useful.

Link to this post | posted 13 Apr, 2017 21:15

cdshaffer

Marsha,
Happy to help. It's too bad all the updates I wrote last fall were too late for inclusion in the SEA VM for 2017. The good news is that its fairly easy for me to set up a run on a whole phage, the computer does all the hard work anyway. You can get the full report from this link. The output is different that what is produced with the older version. The report now focus on the human annotated genes more and the auto-annotations less. I hope you find it useful.

Posted in: Starterator → phage that crash starterator

Link to this post \| posted 12 Apr, 2017 18:16
cdshaffer	OK, It looks like your VM may be stuck on an old version of the database as I can see purgamenstris in my local phamerator database and I can see it on the phamerator.org website listed with the other cluster N phages. It may be that your VM cannot get to the internet or some other issue with the auto-update function of phamerator. You can test the VM's access to the internet if you open either chrome or firefox (both should be in the left hand icon bar) and make sure you can open a web page. If its the auto-update system you could try to force an update to the database. In phamerator select edit => preferences and click the "force database update" button. Then be patient as it can take a while before anything visible happens, (depends on your exact VM/host computer setup; takes about 3 minutes with a really fast hard drive, up to 10+ minutes on the sloweest systems). At some point you should get a button to "restart now", click that, then wait a while longer. Eventually phamerator will become available again and you will see a "database is already the newest version" message at the bottom of the window. If the internet is working for the VM and the force update does not fix then post again.

Link to this post | posted 12 Apr, 2017 18:16

cdshaffer

OK,
It looks like your VM may be stuck on an old version of the database as I can see purgamenstris in my local phamerator database and I can see it on the phamerator.org website listed with the other cluster N phages.

It may be that your VM cannot get to the internet or some other issue with the auto-update function of phamerator.

You can test the VM's access to the internet if you open either chrome or firefox (both should be in the left hand icon bar) and make sure you can open a web page.

If its the auto-update system you could try to force an update to the database. In phamerator select edit => preferences and click the "force database update" button. Then be patient as it can take a while before anything visible happens, (depends on your exact VM/host computer setup; takes about 3 minutes with a really fast hard drive, up to 10+ minutes on the sloweest systems). At some point you should get a button to "restart now", click that, then wait a while longer. Eventually phamerator will become available again and you will see a "database is already the newest version" message at the bottom of the window.

If the internet is working for the VM and the force update does not fix then post again.

Posted in: Phamerator → Missing phage in Phamerator database

← previous
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
next →

Recent Activity

All posts created by cdshaffer