SEA-PHAGES | undetermined tRNA's

Link to this post \| posted 27 Apr, 2017 21:46
cdshaffer	Two questions: simple one first: What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes? Now with complications: We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type. Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan): `ca c g t-a g-c t-a c-g a-t c-g a-t tg t cactc a aa a !!!!! a t ttcg gtgag c g !!!! t tt g aagc a gca a g g-c t-a c-g t-a a-t a a g c gc tRNA-?(Ala\|Gly)(gc) 73 bases, %GC = 46.6 Sequence [97925,97997] Primary sequence for tRNA-?(Ala\|Gly)(gc) 1 . 10 . 20 . 30 . 40 . 50 tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag ttcaagtctcactgtgacagcca` What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Link to this post | posted 27 Apr, 2017 21:46

Two questions: simple one first:

What do we put (if anything) in the minimalstic DNA Master file with only the genbank reportable functions for our tRNA genes?

Now with complications:

We have several tRNA's reported mostly by tRNA scan that have the type as "undet" with anticodon of NNN. Some of these are reported by Aragorn with a type and anticodon so we use the Aragorn result for the final determination of amino acid and anti-codon, but how should we annotate those undet tRNA's if they are either not reported by aragorn or aragorn also gives an undetermined type.

Here is an example from Aragorn (this tRNA has an Infernal score of 40.1 from tRNA scan):


                 ca
                c
               g
             t-a
             g-c
             t-a
             c-g
             a-t
             c-g
             a-t     tg
            t   cactc  a
     aa    a    !!!!!  a
    t  ttcg     gtgag  c
   g   !!!!     t    tt
   g   aagc    a
    gca    a   g
            g-c
            t-a
            c-g
            t-a
            a-t
           a   a
           g  c
            gc
    tRNA-?(Ala|Gly)(gc)
    73 bases, %GC = 46.6
    Sequence [97925,97997]
Primary sequence for tRNA-?(Ala|Gly)(gc)
1   .   10    .   20    .   30    .   40    .   50
tgtcacatagcttaatgggcaaagcagtctaaggccatagacgatgtgag
ttcaagtctcactgtgacagcca

What should be entered into the notes field of the "minimalistic" file in these cases where the exact anti-codon remains ambiguous.

Link to this post \| posted 05 May, 2017 16:11
welkin	You need to include the amino acid and the anticodon for tRNAs for GenBank ready minimal files. If both programs are undetermined, you can use "tRNA other" and the anticodon. If tRNA scan has made up its mind, and ARagorn hasn't, use the tRNA scan decision.

Recent Activity

undetermined tRNA's