Welcome to the forums at seaphages.org. Please feel free to ask any questions related to the SEA-PHAGES program. Any logged-in user may post new topics and reply to existing topics. If you'd like to see a new forum created, please contact us using our form or email us at info@seaphages.org.
Recent Activity
JustinA posted in Plaques appear on spot test, don't appear in titer
Viknesh Sivanathan posted in Plaques appear on spot test, don't appear in titer
JustinA posted in Plaques appear on spot test, don't appear in titer
Viknesh Sivanathan posted in Plaques appear on spot test, don't appear in titer
RyanWheeler posted in Plaques appear on spot test, don't appear in titer
annotating attP site
Link to this post | posted 18 Aug, 2017 01:42 | |
---|---|
|
Hi All, If we think we have identified the attP site, should we annotate it? And if so, how? For example, for Sulley (K1): AttP Site Start: 32614 Stop: 32641 Sequence: ggttcaattcccggcagctccacgagta Thanks! Jordan |
Link to this post | posted 31 Oct, 2017 15:31 | |
---|---|
|
Hi Jordan, That's great that you found it; but no, we are not including attPs in annotations for GenBank. Best, Welkin |