Welcome to the forums at seaphages.org. Please feel free to ask any questions related to the SEA-PHAGES program. Any logged-in user may post new topics and reply to existing topics. If you'd like to see a new forum created, please contact us using our form or email us at info@seaphages.org.
Recent Activity
Debbie Jacobs-Sera posted in Two endolysins?
adiaz posted in Two endolysins?
sklambet@ncsu.edu posted in Tail Assembly Chaperone- Translational Frameshift
Lee Hughes posted in Tail Assembly Chaperone- Translational Frameshift
sklambet@ncsu.edu posted in Tail Assembly Chaperone- Translational Frameshift
annotating attP site
| Link to this post | posted 18 Aug, 2017 01:42 | |
|---|---|
|
Hi All, If we think we have identified the attP site, should we annotate it? And if so, how? For example, for Sulley (K1): AttP Site Start: 32614 Stop: 32641 Sequence: ggttcaattcccggcagctccacgagta Thanks! Jordan |
| Link to this post | posted 31 Oct, 2017 15:31 | |
|---|---|
|
Hi Jordan, That's great that you found it; but no, we are not including attPs in annotations for GenBank. Best, Welkin |
| Link to this post | posted 12 Feb, 2025 22:14 | |
|---|---|
|
bump - still not annotating attPs? |
| Link to this post | posted 12 Feb, 2025 23:55 | |
|---|---|
|
Nope. Are you experimentally determining them? Are they like other published AttPs? It is a good question to ask. For now, it can be kept in the DNA Master files the annotation notes that you submit on phagesDB. debbie |
| Link to this post | posted 13 Feb, 2025 13:04 | |
|---|---|
|
|
The one we found is the same as published attP - specifically, we have a cluster AS phage (Atlantica AS3), and it has the same attP that was published for Galaxy (AS1) in Klyczek et al 2017 "Tales of diversity" (38 bp homology to 3' end of Arthrobacter tRNA-fMet). We just found it, so we haven't done much by way of confirmation, but it does seem to be strongly conserved within cluster. We'll put it in as a note for now, and I'll update if we do find the time to check the lysogen attL/R. |