Welcome to the forums at seaphages.org. Please feel free to ask any questions related to the SEA-PHAGES program. Any logged-in user may post new topics and reply to existing topics. If you'd like to see a new forum created, please contact us using our form or email us at info@seaphages.org.
Recent Activity
annotating attP site
| Link to this post | posted 18 Aug, 2017 01:42 | |
|---|---|
|
Hi All, If we think we have identified the attP site, should we annotate it? And if so, how? For example, for Sulley (K1): AttP Site Start: 32614 Stop: 32641 Sequence: ggttcaattcccggcagctccacgagta Thanks! Jordan |
| Link to this post | posted 31 Oct, 2017 15:31 | |
|---|---|
|
Hi Jordan, That's great that you found it; but no, we are not including attPs in annotations for GenBank. Best, Welkin |